mirror of
https://git.savannah.gnu.org/git/parallel.git
synced 2024-11-21 21:47:54 +00:00
Released as 20210822 ('Kabul')
This commit is contained in:
Ole Tange
parent
5adcd33f7b
commit
4e6f4644f4
29
NEWS
29
NEWS
|
|
@ -1,8 +1,32 @@
|
|||
20210822
|
||||
|
||||
New in this release:
|
||||
|
||||
* --ctag/--ctagstring colors the tag in different colors for each job.
|
||||
|
||||
* You can use unit prefixes (k, m, g, etc) with -n -N -L.
|
||||
|
||||
* Bug fixes and man page updates.
|
||||
|
||||
News about GNU Parallel:
|
||||
|
||||
* Parallelising jobs with GNU parallel
|
||||
https://blog.ronin.cloud/gnu-parallel/
|
||||
|
||||
* Use multiple CPU Cores with your Linux commands - awk, sed, bzip2,
|
||||
grep, wc, etc. https://cdmana.com/2021/07/20210728132344693t.html
|
||||
|
||||
* How to execute commands in parallel in Linux
|
||||
https://net2.com/how-to-execute-commands-in-parallel-in-linux/
|
||||
|
||||
|
||||
20210722
|
||||
|
||||
New in this release:
|
||||
|
||||
* --results no longer prints the result to standard output (stdout) as voted in https://lists.gnu.org/archive/html/parallel/2020-12/msg00003.html
|
||||
* --results no longer prints the result to standard output (stdout) as
|
||||
voted in
|
||||
https://lists.gnu.org/archive/html/parallel/2020-12/msg00003.html
|
||||
|
||||
* parset supports associative arrays in bash, ksh, zsh.
|
||||
|
||||
|
|
@ -12,7 +36,8 @@ New in this release:
|
|||
|
||||
News about GNU Parallel:
|
||||
|
||||
* Cleaning Up Scanned Documents with Open Source Tools https://kaerumy.medium.com/cleaning-up-scanned-documents-with-open-source-tools-9d87e15305b
|
||||
* Cleaning Up Scanned Documents with Open Source Tools
|
||||
https://kaerumy.medium.com/cleaning-up-scanned-documents-with-open-source-tools-9d87e15305b
|
||||
|
||||
|
||||
20210622
|
||||
|
|
|
|||
24
README
24
README
|
|
@ -57,11 +57,11 @@ document.
|
|||
|
||||
Full installation of GNU Parallel is as simple as:
|
||||
|
||||
wget https://ftpmirror.gnu.org/parallel/parallel-20210722.tar.bz2
|
||||
wget https://ftpmirror.gnu.org/parallel/parallel-20210722.tar.bz2.sig
|
||||
gpg parallel-20210722.tar.bz2.sig
|
||||
bzip2 -dc parallel-20210722.tar.bz2 | tar xvf -
|
||||
cd parallel-20210722
|
||||
wget https://ftpmirror.gnu.org/parallel/parallel-20210822.tar.bz2
|
||||
wget https://ftpmirror.gnu.org/parallel/parallel-20210822.tar.bz2.sig
|
||||
gpg parallel-20210822.tar.bz2.sig
|
||||
bzip2 -dc parallel-20210822.tar.bz2 | tar xvf -
|
||||
cd parallel-20210822
|
||||
./configure && make && sudo make install
|
||||
|
||||
|
||||
|
|
@ -70,11 +70,11 @@ Full installation of GNU Parallel is as simple as:
|
|||
If you are not root you can add ~/bin to your path and install in
|
||||
~/bin and ~/share:
|
||||
|
||||
wget https://ftpmirror.gnu.org/parallel/parallel-20210722.tar.bz2
|
||||
wget https://ftpmirror.gnu.org/parallel/parallel-20210722.tar.bz2.sig
|
||||
gpg parallel-20210722.tar.bz2.sig
|
||||
bzip2 -dc parallel-20210722.tar.bz2 | tar xvf -
|
||||
cd parallel-20210722
|
||||
wget https://ftpmirror.gnu.org/parallel/parallel-20210822.tar.bz2
|
||||
wget https://ftpmirror.gnu.org/parallel/parallel-20210822.tar.bz2.sig
|
||||
gpg parallel-20210822.tar.bz2.sig
|
||||
bzip2 -dc parallel-20210822.tar.bz2 | tar xvf -
|
||||
cd parallel-20210822
|
||||
./configure --prefix=$HOME && make && make install
|
||||
|
||||
Or if your system lacks 'make' you can simply copy src/parallel
|
||||
|
|
@ -122,8 +122,8 @@ will love you for it.
|
|||
When using programs that use GNU Parallel to process data for
|
||||
publication please cite:
|
||||
|
||||
Tange, O. (2021, July 22). GNU Parallel 20210722 ('Blue Unity').
|
||||
Zenodo. https://doi.org/10.5281/zenodo.5123056
|
||||
Tange, O. (2021, August 22). GNU Parallel 20210822 ('Kabul').
|
||||
Zenodo. https://doi.org/10.5281/zenodo.5233953
|
||||
|
||||
Copyright (C) 2007, 2008, 2009, 2010, 2011, 2012, 2013, 2014, 2015,
|
||||
2016, 2017, 2018, 2019, 2020, 2021 Ole Tange, http://ole.tange.dk and
|
||||
|
|
|
|||
20
configure
vendored
20
configure
vendored
|
|
@ -1,6 +1,6 @@
|
|||
#! /bin/sh
|
||||
# Guess values for system-dependent variables and create Makefiles.
|
||||
# Generated by GNU Autoconf 2.69 for parallel 20210722.
|
||||
# Generated by GNU Autoconf 2.69 for parallel 20210822.
|
||||
#
|
||||
# Report bugs to <bug-parallel@gnu.org>.
|
||||
#
|
||||
|
|
@ -579,8 +579,8 @@ MAKEFLAGS=
|
|||
# Identity of this package.
|
||||
PACKAGE_NAME='parallel'
|
||||
PACKAGE_TARNAME='parallel'
|
||||
PACKAGE_VERSION='20210722'
|
||||
PACKAGE_STRING='parallel 20210722'
|
||||
PACKAGE_VERSION='20210822'
|
||||
PACKAGE_STRING='parallel 20210822'
|
||||
PACKAGE_BUGREPORT='bug-parallel@gnu.org'
|
||||
PACKAGE_URL=''
|
||||
|
||||
|
|
@ -1214,7 +1214,7 @@ if test "$ac_init_help" = "long"; then
|
|||
# Omit some internal or obsolete options to make the list less imposing.
|
||||
# This message is too long to be a string in the A/UX 3.1 sh.
|
||||
cat <<_ACEOF
|
||||
\`configure' configures parallel 20210722 to adapt to many kinds of systems.
|
||||
\`configure' configures parallel 20210822 to adapt to many kinds of systems.
|
||||
|
||||
Usage: $0 [OPTION]... [VAR=VALUE]...
|
||||
|
||||
|
|
@ -1281,7 +1281,7 @@ fi
|
|||
|
||||
if test -n "$ac_init_help"; then
|
||||
case $ac_init_help in
|
||||
short | recursive ) echo "Configuration of parallel 20210722:";;
|
||||
short | recursive ) echo "Configuration of parallel 20210822:";;
|
||||
esac
|
||||
cat <<\_ACEOF
|
||||
|
||||
|
|
@ -1357,7 +1357,7 @@ fi
|
|||
test -n "$ac_init_help" && exit $ac_status
|
||||
if $ac_init_version; then
|
||||
cat <<\_ACEOF
|
||||
parallel configure 20210722
|
||||
parallel configure 20210822
|
||||
generated by GNU Autoconf 2.69
|
||||
|
||||
Copyright (C) 2012 Free Software Foundation, Inc.
|
||||
|
|
@ -1374,7 +1374,7 @@ cat >config.log <<_ACEOF
|
|||
This file contains any messages produced by compilers while
|
||||
running configure, to aid debugging if configure makes a mistake.
|
||||
|
||||
It was created by parallel $as_me 20210722, which was
|
||||
It was created by parallel $as_me 20210822, which was
|
||||
generated by GNU Autoconf 2.69. Invocation command line was
|
||||
|
||||
$ $0 $@
|
||||
|
|
@ -2237,7 +2237,7 @@ fi
|
|||
|
||||
# Define the identity of the package.
|
||||
PACKAGE='parallel'
|
||||
VERSION='20210722'
|
||||
VERSION='20210822'
|
||||
|
||||
|
||||
cat >>confdefs.h <<_ACEOF
|
||||
|
|
@ -2880,7 +2880,7 @@ cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
|
|||
# report actual input values of CONFIG_FILES etc. instead of their
|
||||
# values after options handling.
|
||||
ac_log="
|
||||
This file was extended by parallel $as_me 20210722, which was
|
||||
This file was extended by parallel $as_me 20210822, which was
|
||||
generated by GNU Autoconf 2.69. Invocation command line was
|
||||
|
||||
CONFIG_FILES = $CONFIG_FILES
|
||||
|
|
@ -2942,7 +2942,7 @@ _ACEOF
|
|||
cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
|
||||
ac_cs_config="`$as_echo "$ac_configure_args" | sed 's/^ //; s/[\\""\`\$]/\\\\&/g'`"
|
||||
ac_cs_version="\\
|
||||
parallel config.status 20210722
|
||||
parallel config.status 20210822
|
||||
configured by $0, generated by GNU Autoconf 2.69,
|
||||
with options \\"\$ac_cs_config\\"
|
||||
|
||||
|
|
|
|||
|
|
@ -1,4 +1,4 @@
|
|||
AC_INIT([parallel], [20210722], [bug-parallel@gnu.org])
|
||||
AC_INIT([parallel], [20210822], [bug-parallel@gnu.org])
|
||||
AM_INIT_AUTOMAKE([-Wall -Werror foreign])
|
||||
AC_CONFIG_HEADERS([config.h])
|
||||
AC_CONFIG_FILES([
|
||||
|
|
|
|||
10
doc/haikus
10
doc/haikus
|
|
@ -4,7 +4,9 @@
|
|||
|
||||
Quote of the month:
|
||||
|
||||
Have you heard of our lord and saviour GNU parallel? https://gnu.org/software/pa
|
||||
I really liked GNU Parallel http://gnu.org/software/parallel/
|
||||
one of the best tool to execute parallel jobs in the shell
|
||||
-- Luca Molteni @volothamp@twitter
|
||||
|
||||
Have you heard of our lord and saviour GNU parallel?
|
||||
-- kxyne @Kxyne@twitter
|
||||
|
|
@ -126,7 +128,11 @@ https://negfeedback.blogspot.com/2020/05/indispensable-command-line-tools.html
|
|||
|
||||
=== Used ===
|
||||
|
||||
We use gnu parallel now - and happier for it.
|
||||
Safe to say, @GnuParallel was a life changer during my PhD! It helped
|
||||
me optimise so many of my tasks and analyses.
|
||||
-- Parice Brandies @PariceBrandies@twitter
|
||||
|
||||
We use gnu parallel now - and happier for it.
|
||||
-- Ben Davies @benjamindavies@twitter
|
||||
|
||||
GNU Parallel makes my life so much easier.
|
||||
|
|
|
|||
|
|
@ -100,7 +100,7 @@ lbry://@GnuParallel#4/parallel-20210322.tar.bz2
|
|||
#
|
||||
# Tags: gnu parallel software
|
||||
|
||||
|
||||
. .last-doitag.txt
|
||||
file_path="`pwd`/parallel-$YYYYMMDD.tar.bz2"
|
||||
title="GNU Parallel $YYYYMMDD ('$SPCTAG')"
|
||||
name="GNU-Parallel-$YYYYMMDD-$TAG"
|
||||
|
|
@ -255,30 +255,32 @@ from:tange@gnu.org
|
|||
to:parallel@gnu.org, bug-parallel@gnu.org
|
||||
stable-bcc: Jesse Alama <jessealama@fastmail.fm>
|
||||
|
||||
Subject: GNU Parallel 20210822 ('South Africa/Kristina Timanovskaya/turkish fire/greek fire/tysk syndflod/Tunesia') released <<[stable]>>
|
||||
Subject: GNU Parallel 20210822 ('Kabul') released
|
||||
|
||||
GNU Parallel 20210822 ('') <<[stable]>> has been released. It is available for download at: lbry://@GnuParallel:4
|
||||
|
||||
<<No new functionality was introduced so this is a good candidate for a stable release.>>
|
||||
GNU Parallel 20210822 ('Kabul') has been released. It is available for download at: lbry://@GnuParallel:4
|
||||
|
||||
Quote of the month:
|
||||
|
||||
<<>>
|
||||
Safe to say, @GnuParallel was a life changer during my PhD! It helped
|
||||
me optimise so many of my tasks and analyses.
|
||||
-- Parice Brandies @PariceBrandies@twitter
|
||||
|
||||
New in this release:
|
||||
|
||||
<<>>
|
||||
* --ctag/--ctagstring colors the tag in different colors for each job.
|
||||
|
||||
* You can use unit prefixes (k, m, g, etc) with -n -N -L.
|
||||
|
||||
* Bug fixes and man page updates.
|
||||
|
||||
|
||||
News about GNU Parallel:
|
||||
|
||||
<<>>
|
||||
https://cdmana.com/2021/07/20210728132344693t.html
|
||||
* Parallelising jobs with GNU parallel https://blog.ronin.cloud/gnu-parallel/
|
||||
|
||||
https://github.com/gibbslab/biobash uses GNU Parallel
|
||||
* Use multiple CPU Cores with your Linux commands - awk, sed, bzip2, grep, wc, etc. https://cdmana.com/2021/07/20210728132344693t.html
|
||||
|
||||
https://net2.com/how-to-execute-commands-in-parallel-in-linux/
|
||||
* How to execute commands in parallel in Linux https://net2.com/how-to-execute-commands-in-parallel-in-linux/
|
||||
|
||||
|
||||
Get the book: GNU Parallel 2018 http://www.lulu.com/shop/ole-tange/gnu-parallel-2018/paperback/product-23558902.html
|
||||
|
|
|
|||
|
|
@ -1,7 +1,7 @@
|
|||
<directory name="parallel" rev="311" vrev="1" srcmd5="4db07b555bac8c95b748e4b27d7b8ec2">
|
||||
<entry name="PKGBUILD" md5="efe5dba5d697d74243ed766562a7ced1" size="936" mtime="1626984745" />
|
||||
<entry name="parallel-20210722.tar.bz2" md5="bc317c08d26f81c81ef764b8e421a0e1" size="2248888" mtime="1626984745" />
|
||||
<entry name="parallel.spec" md5="4657b2121ab380c968d795952d8405a3" size="5630" mtime="1626984745" />
|
||||
<entry name="parallel_20210722.dsc" md5="abe14d022d2190009c72ba95cd1c332b" size="556" mtime="1626984746" />
|
||||
<entry name="parallel_20210722.tar.gz" md5="f378ff0a5e4aeb3599747bf94f08b2b7" size="2490792" mtime="1626984746" />
|
||||
<directory name="parallel" rev="312" vrev="1" srcmd5="3b2d528a15b0898ec9a2649f393cb24d">
|
||||
<entry name="PKGBUILD" md5="872019301c50c38abc39ba04937925d1" size="936" mtime="1629661749" />
|
||||
<entry name="parallel-20210822.tar.bz2" md5="1a9a3282c6287ad43936497f4c0fe61b" size="2267536" mtime="1629661749" />
|
||||
<entry name="parallel.spec" md5="1360338a8e6c60305fb2c9a27db7a902" size="5630" mtime="1629661749" />
|
||||
<entry name="parallel_20210822.dsc" md5="48d6e04ee967486209117322306aa3bd" size="556" mtime="1629661749" />
|
||||
<entry name="parallel_20210822.tar.gz" md5="6f1ecb52bdf18a8ac846f3b5feb8c60f" size="2509459" mtime="1629661750" />
|
||||
</directory>
|
||||
|
|
|
|||
|
|
@ -1,7 +1,7 @@
|
|||
|
||||
Summary: Shell tool for executing jobs in parallel
|
||||
Name: parallel
|
||||
Version: 20210722
|
||||
Version: 20210822
|
||||
Release: 1.3
|
||||
License: GPL-3.0-or-later
|
||||
Group: Productivity/File utilities
|
||||
|
|
|
|||
|
|
@ -385,7 +385,7 @@ _parset_main() {
|
|||
return 255
|
||||
fi
|
||||
if [ "$_parset_NAME" = "--version" ] ; then
|
||||
echo "parset 20210723 (GNU parallel `parallel --minversion 1`)"
|
||||
echo "parset 20210822 (GNU parallel `parallel --minversion 1`)"
|
||||
echo "Copyright (C) 2007-2021 Ole Tange, http://ole.tange.dk and Free Software"
|
||||
echo "Foundation, Inc."
|
||||
echo "License GPLv3+: GNU GPL version 3 or later <https://gnu.org/licenses/gpl.html>"
|
||||
|
|
|
|||
|
|
@ -384,7 +384,7 @@ _parset_main() {
|
|||
return 255
|
||||
fi
|
||||
if [ "$_parset_NAME" = "--version" ] ; then
|
||||
echo "parset 20210723 (GNU parallel `parallel --minversion 1`)"
|
||||
echo "parset 20210822 (GNU parallel `parallel --minversion 1`)"
|
||||
echo "Copyright (C) 2007-2021 Ole Tange, http://ole.tange.dk and Free Software"
|
||||
echo "Foundation, Inc."
|
||||
echo "License GPLv3+: GNU GPL version 3 or later <https://gnu.org/licenses/gpl.html>"
|
||||
|
|
|
|||
|
|
@ -385,7 +385,7 @@ _parset_main() {
|
|||
return 255
|
||||
fi
|
||||
if [ "$_parset_NAME" = "--version" ] ; then
|
||||
echo "parset 20210723 (GNU parallel `parallel --minversion 1`)"
|
||||
echo "parset 20210822 (GNU parallel `parallel --minversion 1`)"
|
||||
echo "Copyright (C) 2007-2021 Ole Tange, http://ole.tange.dk and Free Software"
|
||||
echo "Foundation, Inc."
|
||||
echo "License GPLv3+: GNU GPL version 3 or later <https://gnu.org/licenses/gpl.html>"
|
||||
|
|
|
|||
|
|
@ -363,7 +363,7 @@ _parset_main() {
|
|||
return 255
|
||||
fi
|
||||
if [ "$_parset_NAME" = "--version" ] ; then
|
||||
echo "parset 20210723 (GNU parallel `parallel --minversion 1`)"
|
||||
echo "parset 20210822 (GNU parallel `parallel --minversion 1`)"
|
||||
echo "Copyright (C) 2007-2021 Ole Tange, http://ole.tange.dk and Free Software"
|
||||
echo "Foundation, Inc."
|
||||
echo "License GPLv3+: GNU GPL version 3 or later <https://gnu.org/licenses/gpl.html>"
|
||||
|
|
|
|||
|
|
@ -365,7 +365,7 @@ _parset_main() {
|
|||
return 255
|
||||
fi
|
||||
if [ "$_parset_NAME" = "--version" ] ; then
|
||||
echo "parset 20210723 (GNU parallel `parallel --minversion 1`)"
|
||||
echo "parset 20210822 (GNU parallel `parallel --minversion 1`)"
|
||||
echo "Copyright (C) 2007-2021 Ole Tange, http://ole.tange.dk and Free Software"
|
||||
echo "Foundation, Inc."
|
||||
echo "License GPLv3+: GNU GPL version 3 or later <https://gnu.org/licenses/gpl.html>"
|
||||
|
|
|
|||
|
|
@ -390,7 +390,7 @@ _parset_main() {
|
|||
return 255
|
||||
fi
|
||||
if [ "$_parset_NAME" = "--version" ] ; then
|
||||
echo "parset 20210723 (GNU parallel `parallel --minversion 1`)"
|
||||
echo "parset 20210822 (GNU parallel `parallel --minversion 1`)"
|
||||
echo "Copyright (C) 2007-2021 Ole Tange, http://ole.tange.dk and Free Software"
|
||||
echo "Foundation, Inc."
|
||||
echo "License GPLv3+: GNU GPL version 3 or later <https://gnu.org/licenses/gpl.html>"
|
||||
|
|
|
|||
|
|
@ -355,7 +355,7 @@ _parset_main() {
|
|||
return 255
|
||||
fi
|
||||
if [ "$_parset_NAME" = "--version" ] ; then
|
||||
echo "parset 20210723 (GNU parallel `parallel --minversion 1`)"
|
||||
echo "parset 20210822 (GNU parallel `parallel --minversion 1`)"
|
||||
echo "Copyright (C) 2007-2021 Ole Tange, http://ole.tange.dk and Free Software"
|
||||
echo "Foundation, Inc."
|
||||
echo "License GPLv3+: GNU GPL version 3 or later <https://gnu.org/licenses/gpl.html>"
|
||||
|
|
|
|||
|
|
@ -26,7 +26,7 @@
|
|||
use strict;
|
||||
use Getopt::Long;
|
||||
$Global::progname="niceload";
|
||||
$Global::version = 20210723;
|
||||
$Global::version = 20210822;
|
||||
Getopt::Long::Configure("bundling","require_order");
|
||||
get_options_from_array(\@ARGV) || die_usage();
|
||||
if($opt::version) {
|
||||
|
|
|
|||
25
src/parallel
25
src/parallel
|
|
@ -562,7 +562,8 @@ sub pipe_part_files(@) {
|
|||
my ($file) = @_;
|
||||
my $buf = "";
|
||||
if(not -f $file and not -b $file) {
|
||||
::error("$file is not a seekable file.");
|
||||
::error("--pipepart only works on seekable files, not streams/pipes.",
|
||||
"$file is not a seekable file.");
|
||||
::wait_and_exit(255);
|
||||
}
|
||||
my $header = find_header(\$buf,open_or_exit($file));
|
||||
|
|
@ -2240,7 +2241,7 @@ sub check_invalid_option_combinations() {
|
|||
|
||||
sub init_globals() {
|
||||
# Defaults:
|
||||
$Global::version = 20210723;
|
||||
$Global::version = 20210822;
|
||||
$Global::progname = 'parallel';
|
||||
$::name = "GNU Parallel";
|
||||
$Global::infinity = 2**31;
|
||||
|
|
@ -5051,8 +5052,8 @@ sub usage() {
|
|||
"If you use programs that use GNU Parallel to process data for an article in a",
|
||||
"scientific publication, please cite:",
|
||||
"",
|
||||
" Tange, O. (2021, July 22). GNU Parallel 20210722 ('Blue Unity').",
|
||||
" Zenodo. https://doi.org/10.5281/zenodo.5123056",
|
||||
" Tange, O. (2021, August 22). GNU Parallel 20210822 ('Kabul').",
|
||||
" Zenodo. https://doi.org/10.5281/zenodo.5233953",
|
||||
"",
|
||||
# Before changing this line, please read
|
||||
# https://www.gnu.org/software/parallel/parallel_design.html#Citation-notice
|
||||
|
|
@ -5082,8 +5083,8 @@ sub citation_notice() {
|
|||
"If you use programs that use GNU Parallel to process data for an article in a",
|
||||
"scientific publication, please cite:",
|
||||
"",
|
||||
" Tange, O. (2021, July 22). GNU Parallel 20210722 ('Blue Unity').",
|
||||
" Zenodo. https://doi.org/10.5281/zenodo.5123056",
|
||||
" Tange, O. (2021, August 22). GNU Parallel 20210822 ('Kabul').",
|
||||
" Zenodo. https://doi.org/10.5281/zenodo.5233953",
|
||||
"",
|
||||
# Before changing this line, please read
|
||||
# https://www.gnu.org/software/parallel/parallel_design.html#Citation-notice and
|
||||
|
|
@ -5206,20 +5207,20 @@ sub citation() {
|
|||
"If you use programs that use GNU Parallel to process data for an article in a",
|
||||
"scientific publication, please cite:",
|
||||
"",
|
||||
"\@software{tange_2021_5123056,",
|
||||
"\@software{tange_2021_5233953,",
|
||||
" author = {Tange, Ole},",
|
||||
" title = {GNU Parallel 20210722 ('Blue Unity')},",
|
||||
" month = Jul,",
|
||||
" title = {GNU Parallel 20210822 ('Kabul')},",
|
||||
" month = Aug,",
|
||||
" year = 2021,",
|
||||
" note = {{GNU Parallel is a general parallelizer to run",
|
||||
" multiple serial command line programs in parallel",
|
||||
" without changing them.}},",
|
||||
" publisher = {Zenodo},",
|
||||
" doi = {10.5281/zenodo.5123056},",
|
||||
" url = {https://doi.org/10.5281/zenodo.5123056}",
|
||||
" doi = {10.5281/zenodo.5233953},",
|
||||
" url = {https://doi.org/10.5281/zenodo.5233953}",
|
||||
"}",
|
||||
"",
|
||||
"(Feel free to use \\nocite{tange_2021_5123056})",
|
||||
"(Feel free to use \\nocite{tange_2021_5233953})",
|
||||
"",
|
||||
# Before changing this line, please read
|
||||
# https://www.gnu.org/software/parallel/parallel_design.html#Citation-notice and
|
||||
|
|
|
|||
|
|
@ -1621,14 +1621,16 @@ B<--pipepart> has a few limitations:
|
|||
|
||||
The file must be a normal file or a block device (technically it must
|
||||
be seekable) and must be given using B<-a> or B<::::>. The file cannot
|
||||
be a pipe or a fifo as they are not seekable.
|
||||
be a pipe, a fifo, or a stream as they are not seekable.
|
||||
|
||||
If using a block device with lot of NUL bytes, remember to set
|
||||
B<--recend ''>.
|
||||
|
||||
=item *
|
||||
|
||||
Record counting (B<-N>) and line counting (B<-L>/B<-l>) do not work.
|
||||
Record counting (B<-N>) and line counting (B<-L>/B<-l>) do not
|
||||
work. Instead use B<--recstart> and B<--recend> to determine
|
||||
where records end.
|
||||
|
||||
=back
|
||||
|
||||
|
|
@ -1880,9 +1882,9 @@ it to the command.
|
|||
Only used with B<--pipe>.
|
||||
|
||||
|
||||
=item B<--results> I<name> (alpha testing)
|
||||
=item B<--results> I<name> (beta testing)
|
||||
|
||||
=item B<--res> I<name> (alpha testing)
|
||||
=item B<--res> I<name> (beta testing)
|
||||
|
||||
Save the output into files.
|
||||
|
||||
|
|
@ -4532,6 +4534,31 @@ To call B<myprog> with the sequence as argument run:
|
|||
'read a; echo Name: "$a"; myprog $(tr -d "\n")'
|
||||
|
||||
|
||||
=head2 EXAMPLE: Call program with interleaved FASTQ records
|
||||
|
||||
FASTQ files have the format:
|
||||
|
||||
@M10991:61:000000000-A7EML:1:1101:14011:1001 1:N:0:28
|
||||
CTCCTAGGTCGGCATGATGGGGGAAGGAGAGCATGGGAAGAAATGAGAGAGTAGCAAGG
|
||||
+
|
||||
#8BCCGGGGGFEFECFGGGGGGGGG@;FFGGGEG@FF<EE<@FFC,CEGCCGGFF<FGF
|
||||
|
||||
Interleaved FASTQ starts with a line like these:
|
||||
|
||||
@HWUSI-EAS100R:6:73:941:1973#0/1
|
||||
@EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG
|
||||
@EAS139:136:FC706VJ:2:2104:15343:197393 1:N:18:1
|
||||
|
||||
where '/1' and ' 1:' determines this is read 1.
|
||||
|
||||
This will cut big.fq into one chunk per CPU core and pass it on
|
||||
stdin (standard input) to the program fastq-reader:
|
||||
|
||||
parallel --pipepart -a big.fq --block -1 --regexp \
|
||||
--recend '\n' --recstart '@.*(/1| 1:.*)\n[A-Za-z\n\.~]' \
|
||||
fastq-reader
|
||||
|
||||
|
||||
=head2 EXAMPLE: Processing a big file using more CPUs
|
||||
|
||||
To process a big file or some output you can use B<--pipe> to split up
|
||||
|
|
|
|||
|
|
@ -122,7 +122,7 @@ GetOptions(
|
|||
"help" => \$opt::dummy,
|
||||
) || exit(255);
|
||||
$Global::progname = ($0 =~ m:(^|/)([^/]+)$:)[1];
|
||||
$Global::version = 20210723;
|
||||
$Global::version = 20210822;
|
||||
if($opt::version) { version(); exit 0; }
|
||||
@Global::sortoptions =
|
||||
shell_quote(@ARGV_before[0..($#ARGV_before-$#ARGV-1)]);
|
||||
|
|
|
|||
2
src/sql
2
src/sql
|
|
@ -600,7 +600,7 @@ $Global::Initfile && unlink $Global::Initfile;
|
|||
exit ($err);
|
||||
|
||||
sub parse_options {
|
||||
$Global::version = 20210723;
|
||||
$Global::version = 20210822;
|
||||
$Global::progname = 'sql';
|
||||
|
||||
# This must be done first as this may exec myself
|
||||
|
|
|
|||
|
|
@ -86,7 +86,7 @@ doit() {
|
|||
par_nonall() {
|
||||
parallel -j$MAXPROC $RET_TIME_K --delay 0.1 --tag \
|
||||
--nonall $S_POLAR -S "1/sshwithpass minix" --argsep ,:- \
|
||||
'source setupenv 2>/dev/null; . `pwd`/setupenv;' "$@"
|
||||
'source ./setupenv 2>/dev/null; . `pwd`/setupenv;' "$@"
|
||||
# setupenv contains something like this (adapted to the local path and shell)
|
||||
#
|
||||
# PATH=$HOME/bin:$PATH:/usr/local/bin
|
||||
|
|
|
|||
|
|
@ -1,17 +1,17 @@
|
|||
par_big_func 1 7960 191040
|
||||
par_big_func 1 5376 128964
|
||||
par_big_func_name 1 4952 118848
|
||||
par_big_func_name 1 48 1152
|
||||
par_big_var_func_name 1 4960 119040
|
||||
par_big_var_func_name 1 4960 119040
|
||||
par_big_var_func_name 1 3416 81924
|
||||
par_many_args 1 16376 32752
|
||||
par_many_args 1 3624 7248
|
||||
par_many_func 1 4376 105024
|
||||
par_many_func 1 2292 54980
|
||||
par_many_var 1 5116 122784
|
||||
par_many_var 1 1552 37220
|
||||
par_many_var_big_func 1 4388 105312
|
||||
par_many_var_big_func 1 2280 54692
|
||||
par_many_var_func 1 4900 117600
|
||||
par_many_var_func 1 1768 42404
|
||||
par_big_func 1 7968 191232
|
||||
par_big_func 1 5368 128772
|
||||
par_big_func_name 1 4960 119040
|
||||
par_big_func_name 1 40 960
|
||||
par_big_var_func_name 1 4956 118944
|
||||
par_big_var_func_name 1 4956 118944
|
||||
par_big_var_func_name 1 3424 82116
|
||||
par_many_args 1 16400 32800
|
||||
par_many_args 1 3600 7200
|
||||
par_many_func 1 4372 104928
|
||||
par_many_func 1 2296 55076
|
||||
par_many_var 1 5124 122976
|
||||
par_many_var 1 1544 37028
|
||||
par_many_var_big_func 1 4404 105696
|
||||
par_many_var_big_func 1 2264 54308
|
||||
par_many_var_func 1 6624 158976
|
||||
par_many_var_func 1 44 1028
|
||||
|
|
|
|||
|
|
@ -395,7 +395,7 @@ freebsd Works on freebsd.polarhome.com
|
|||
hpux Works on hpux64
|
||||
hpux-ia64 Works on hpux-ia64
|
||||
hurd Works on hurd
|
||||
macosx Works on macosx.polarhome.com
|
||||
macosx Works on macosx
|
||||
mandriva Works on mandriva.polarhome.com
|
||||
miros Works on miros.polarhome.com
|
||||
netbsd Works on netbsd.polarhome.com
|
||||
|
|
@ -1210,11 +1210,11 @@ mandriva 1 2 1 2 3 1 2 3 4
|
|||
miros 1 2 1 2 3 1 2 3 4
|
||||
netbsd parset: Command not found.
|
||||
netbsd arr: Undefined variable.
|
||||
openbsd
|
||||
openbsd 1 2 1 2 3 1 2 3 4
|
||||
openindiana 1 2 1 2 3 1 2 3 4
|
||||
pidora 1 2 1 2 3 1 2 3 4
|
||||
qnx
|
||||
qnx parallel: Warning: Cannot figure out number of cpus. Using 1.
|
||||
qnx parset: Warning: Cannot figure out number of cpus. Using 1.
|
||||
qnx /bin/sh: syntax error: `(' unexpected
|
||||
raspbian 1 2 1 2 3 1 2 3 4
|
||||
redhat 1 2 1 2 3 1 2 3 4
|
||||
|
|
@ -1241,14 +1241,14 @@ miros 1 2 1 2 1 2
|
|||
netbsd start=2: Command not found.
|
||||
netbsd env_parset: Command not found.
|
||||
netbsd arr: Undefined variable.
|
||||
openbsd
|
||||
openbsd 2 3 3 4 4 5
|
||||
openindiana 2 2 3 2 3 4
|
||||
pidora 2 2 3 2 3 4
|
||||
qnx
|
||||
qnx /bin/sh: compgen: cannot execute - No such file or directory
|
||||
qnx /bin/sh: compgen: cannot execute - No such file or directory
|
||||
qnx /bin/sh: compgen: cannot execute - No such file or directory
|
||||
qnx parallel: Warning: Cannot figure out number of cpus. Using 1.
|
||||
qnx parset: Warning: Cannot figure out number of cpus. Using 1.
|
||||
qnx /bin/sh: syntax error: `(' unexpected
|
||||
raspbian 2 2 3 2 3 4
|
||||
redhat 2 2 3 2 3 4
|
||||
|
|
@ -1285,12 +1285,11 @@ mandriva 1 2,1 2 3,1 2 3 4
|
|||
miros 1 2,1 2 3,1 2 3 4
|
||||
netbsd parset: Command not found.
|
||||
netbsd var1: Undefined variable.
|
||||
openbsd ,,
|
||||
openbsd 1 2,1 2 3,1 2 3 4
|
||||
openindiana 1 2,1 2 3,1 2 3 4
|
||||
pidora 1 2,1 2 3,1 2 3 4
|
||||
qnx ,,
|
||||
qnx parallel: Warning: Cannot figure out number of cpus. Using 1.
|
||||
qnx parallel: Warning: Cannot figure out number of cpus. Using 1.
|
||||
qnx parset: Warning: Cannot figure out number of cpus. Using 1.
|
||||
raspbian 1 2,1 2 3,1 2 3 4
|
||||
redhat 1 2,1 2 3,1 2 3 4
|
||||
scosysv 1 2,1 2 3,1 2 3 4
|
||||
|
|
@ -1315,15 +1314,14 @@ miros 1 2,1 2,1 2
|
|||
netbsd start=2: Command not found.
|
||||
netbsd env_parset: Command not found.
|
||||
netbsd var1: Undefined variable.
|
||||
openbsd ,,
|
||||
openbsd 2 3,3 4,4 5
|
||||
openindiana 2,2 3,2 3 4
|
||||
pidora 2,2 3,2 3 4
|
||||
qnx ,,
|
||||
qnx /bin/sh: compgen: cannot execute - No such file or directory
|
||||
qnx /bin/sh: compgen: cannot execute - No such file or directory
|
||||
qnx /bin/sh: compgen: cannot execute - No such file or directory
|
||||
qnx parallel: Warning: Cannot figure out number of cpus. Using 1.
|
||||
qnx parallel: Warning: Cannot figure out number of cpus. Using 1.
|
||||
qnx parset: Warning: Cannot figure out number of cpus. Using 1.
|
||||
raspbian 2,2 3,2 3 4
|
||||
redhat 2,2 3,2 3 4
|
||||
scosysv 2,2 3,2 3 4
|
||||
|
|
|
|||
Loading…
Reference in a new issue